Mature sequence osa-miR5490

Accession numberMIMAT0022123
IDosa-miR5490
Stem-Loop osa-MIR5490
Sequence
uuggauuuuuauuuaggacgg
Get sequence
Deep sequencing19 reads, 2 experiments
Database links
QuickGO function

References

1