Mature sequence osa-miR5487

Accession numberMIMAT0022120
IDosa-miR5487
Stem-Loop osa-MIR5487
Sequence
aaagaugugcauguaguuccg
Get sequence
Deep sequencing reads, experiments

References

1