Mature sequence osa-miR5486

Accession numberMIMAT0022119
IDosa-miR5486
Stem-Loop osa-MIR5486
Sequence
aggggcuugcauauucuacca
Get sequence
Deep sequencing reads, experiments

References

1