Mature sequence pti-miR5476

Accession numberMIMAT0022109
IDpti-miR5476
Stem-Loop pti-MIR5476
Sequence
ugaccgaccgcuacuacucuuu
Get sequence
Deep sequencing reads, experiments

References

1