Mature sequence aca-miR-29a-2-5p

Accession numberMIMAT0021913
IDaca-miR-29a-2-5p
Previous IDsaca-miR-29a-2*
Stem-Loop aca-mir-29a-2
Sequence
ugaccgauuucucuugguguuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).