Mature sequence aca-let-7i-3p

Accession numberMIMAT0021708
IDaca-let-7i-3p
Previous IDsaca-let-7i*
Stem-Loop aca-let-7i
Sequence
cugcgcaagcuacugccuugcua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).