Mature sequence aca-let-7c-5p

Accession numberMIMAT0021696
IDaca-let-7c-5p
Previous IDsaca-let-7c
Stem-Loop aca-let-7c-1 aca-let-7c-2 aca-let-7c-3
Sequence
ugagguaguagguuguaugguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).
2
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).