Mature sequence sbi-miR5389

Accession numberMIMAT0021687
IDsbi-miR5389
Stem-Loop sbi-MIR5389
Sequence
gcuugaguuuaucagccgagu
Get sequence
Deep sequencing reads, experiments

References

1