Mature sequence sbi-miR5387a

Accession numberMIMAT0021685
IDsbi-miR5387a
Previous IDssbi-miR5387
Stem-Loop sbi-MIR5387a
Sequence
uaacacgaaccggugcuaaaggauc
Get sequence
Deep sequencing reads, experiments

References

1