Mature sequence sbi-miR5386

Accession numberMIMAT0021684
IDsbi-miR5386
Stem-Loop sbi-MIR5386
Sequence
cgucgcugucgcgcgcgcug
Get sequence
Deep sequencing reads, experiments

References

1