Mature sequence asu-miR-5345b

Accession numberMIMAT0021539
IDasu-miR-5345b
Stem-Loop asu-mir-5345b
Sequence
aaggcacuggauuggucaguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).