Mature sequence asu-miR-279b-3p

Accession numberMIMAT0021514
IDasu-miR-279b-3p
Previous IDsasu-miR-279b
Stem-Loop asu-mir-279b
Sequence
ugacuagacugauaaccagcuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).