Mature sequence asu-miR-43c-3p

Accession numberMIMAT0021454
IDasu-miR-43c-3p
Previous IDsasu-miR-43c
Stem-Loop asu-mir-43c-1 asu-mir-43c-2
Sequence
uaucacaguucuuugucacccu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).