Mature sequence osa-miR5338

Accession numberMIMAT0021411
IDosa-miR5338
Stem-Loop osa-MIR5338
Sequence
ugaagcuucaguugguuguau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21791435 "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)" Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q J Exp Bot. 62:4943-4954(2011).