Mature sequence isc-miR-5309

Accession numberMIMAT0021379
IDisc-miR-5309
Stem-Loop isc-mir-5309
Sequence
caaugcccauggaaaccccgaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).