Mature sequence mtr-miR5217

Accession numberMIMAT0021175
IDmtr-miR5217
Stem-Loop mtr-MIR5217
Sequence
aggucauuuugaacggucggau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).