Mature sequence hsa-miR-5188

Accession numberMIMAT0021119
IDhsa-miR-5188
Stem-Loop hsa-mir-5188
Sequence
aaucggacccauuuaaaccggag
Get sequence
Deep sequencing95 reads, 47 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).