Mature sequence osa-miR5162

Accession numberMIMAT0021115
IDosa-miR5162
Stem-Loop osa-MIR5162
Sequence
aaaugaccaaaauaccccuagaac
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).