Mature sequence osa-miR5158

• Accession number: MIMAT0021111
• ID: osa-miR5158
• Stem-Loop: osa-MIR5158
• Sequence: ugagccacugggaugaggaugaau
• Deep sequencing: 14 reads, 2 experiments
• Database links:
  • RNAcentral:URS000057C333_39947

References

1. PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).