Mature sequence osa-miR5149

Accession numberMIMAT0021097
IDosa-miR5149
Stem-Loop osa-MIR5149
Sequence
gaggagcugugacgauuuggga
Get sequence
Deep sequencing15 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).