Mature sequence hsa-miR-5091

Accession numberMIMAT0021083
IDhsa-miR-5091
Stem-Loop hsa-mir-5091
Sequence
acggagacgacaagacugugcug
Get sequence
Deep sequencing233 reads, 89 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).