Mature sequence hsa-miR-5087

Accession numberMIMAT0021079
IDhsa-miR-5087
Stem-Loop hsa-mir-5087
Sequence
ggguuuguagcuuugcuggcaug
Get sequence
Deep sequencing4 reads, 4 experiments
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).