Mature sequence gma-miR5041-5p

Accession numberMIMAT0021070
IDgma-miR5041-5p
Previous IDsgma-miR5041
Stem-Loop gma-MIR5041
Sequence
uuucaucuucaacuugcucaa
Get sequence
Deep sequencing reads, experiments

References

1
2