Mature sequence gma-miR5040

Accession numberMIMAT0021067
IDgma-miR5040
Stem-Loop gma-MIR5040
Sequence
augauauauaacaagcaugag
Get sequence
Deep sequencing reads, experiments

References

1