Mature sequence gma-miR5037a

Accession numberMIMAT0021060
IDgma-miR5037a
Previous IDsgma-miR5037
Stem-Loop gma-MIR5037a
Sequence
gccucaaaggcuuccacuacug
Get sequence
Deep sequencing reads, experiments

References

1