Mature sequence gma-miR5036

Accession numberMIMAT0021059
IDgma-miR5036
Stem-Loop gma-MIR5036
Sequence
agaggcccuuggggaggaguaa
Get sequence
Deep sequencing reads, experiments

References

1