Mature sequence gma-miR171h

Accession numberMIMAT0021054
IDgma-miR171h
Stem-Loop gma-MIR171h
Sequence
auugagacgagccgaaucaau
Get sequence
Deep sequencing reads, experiments

References

1