Mature sequence hsa-miR-5010-3p

Accession numberMIMAT0021044
IDhsa-miR-5010-3p
Stem-Loop hsa-mir-5010
Sequence
uuuugugucucccauuccccag
Get sequence
Deep sequencing1207 reads, 132 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).