Mature sequence hsa-miR-5006-3p

Accession numberMIMAT0021034
IDhsa-miR-5006-3p
Stem-Loop hsa-mir-5006
Sequence
uuucccuuuccauccuggcag
Get sequence
Deep sequencing114 reads, 49 experiments
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
2
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).