Mature sequence hsa-miR-548ao-3p

Accession numberMIMAT0021030
IDhsa-miR-548ao-3p
Stem-Loop hsa-mir-548ao
Sequence
aaagaccgugacuacuuuugca
Get sequence
Deep sequencing87 reads, 24 experiments
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).