Mature sequence hsa-miR-4999-3p

Accession numberMIMAT0021018
IDhsa-miR-4999-3p
Stem-Loop hsa-mir-4999
Sequence
ucacuaccugacaauacagu
Get sequence
Deep sequencing38 reads, 25 experiments
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).