Mature sequence dme-miR-988-5p

Accession numberMIMAT0020886
IDdme-miR-988-5p
Stem-Loop dme-mir-988
Sequence
gugugauuuguagcaaagugau
Get sequence
Deep sequencing13064 reads, 49 experiments
Database links
QuickGO function

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).
3
PMID:18463636 "Drosophila endogenous small RNAs bind to Argonaute 2 in somatic cells" Kawamura Y, Saito K, Kin T, Ono Y, Asai K, Sunohara T, Okada TN, Siomi MC, Siomi H Nature. 453:793-797(2008).