Mature sequence dme-miR-2c-5p

Accession number MIMAT0020845
ID dme-miR-2c-5p
Sequence
ucaucaaaaagggcugaagaaagau
Get sequence
Stem-Loop dme-mir-2c

References

1
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).