Mature sequence hvu-miR166c

Accession numberMIMAT0020737
IDhvu-miR166c
Stem-Loop hvu-MIR166c
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).