Mature sequence tcc-miR827

Accession numberMIMAT0020449
IDtcc-miR827
Stem-Loop tcc-MIR827
Sequence
uuagaugaccaucaacaaaca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).