Mature sequence tcc-miR535

Accession numberMIMAT0020448
IDtcc-miR535
Stem-Loop tcc-MIR535
Sequence
ugacaacgauagagagcacgc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).