Mature sequence tcc-miR399d

Accession numberMIMAT0020438
IDtcc-miR399d
Stem-Loop tcc-MIR399d
Sequence
ugccaaaggagauuugcccgg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).