Mature sequence tcc-miR166d

Accession numberMIMAT0020386
IDtcc-miR166d
Stem-Loop tcc-MIR166d
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).