Mature sequence tcc-miR166a

Accession numberMIMAT0020383
IDtcc-miR166a
Stem-Loop tcc-MIR166a
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).