Mature sequence ssp-miR827

Accession numberMIMAT0020279
IDssp-miR827
Stem-Loop ssp-MIR827
Sequence
uuagaugaccaucagcaaaca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21092324 "Identification and expression analysis of microRNAs and targets in the biofuel crop sugarcane" Zanca AS, Vicentini R, Ortiz-Morea FA, Del Bem LE, da Silva MJ, Vincentz M, Nogueira FT BMC Plant Biol. 10:260(2010).