Mature sequence dme-miR-4973-3p

Accession numberMIMAT0020202
IDdme-miR-4973-3p
Stem-Loop dme-mir-4973
Sequence
ugcaacacucacaccacggcaa
Get sequence
Deep sequencing16 reads, 6 experiments
Database links
QuickGO function

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).