Mature sequence cel-miR-4938

Accession numberMIMAT0020144
IDcel-miR-4938
Stem-Loop cel-mir-4938
Sequence
aucaucaugcaucaucagcaugc
Get sequence
Deep sequencing28 reads, 3 experiments

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).