Mature sequence hsa-miR-4667-5p

Accession numberMIMAT0019743
IDhsa-miR-4667-5p
Stem-Loop hsa-mir-4667
Sequence
acuggggagcagaaggagaacc
Get sequence
Deep sequencing238 reads, 73 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).