Mature sequence hsa-miR-4646-5p

Accession numberMIMAT0019707
IDhsa-miR-4646-5p
Stem-Loop hsa-mir-4646
Sequence
acugggaagaggagcugaggga
Get sequence
Deep sequencing44 reads, 24 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).