Mature sequence osa-miR812o-3p

Accession numberMIMAT0019682
IDosa-miR812o-3p
Stem-Loop osa-MIR812o
Sequence
gaacggucaaauguuagacacgga
Get sequence
Deep sequencing823 reads, 2 experiments
Database links
QuickGO function

References

1