Mature sequence osa-miR812o-5p

Accession numberMIMAT0019681
IDosa-miR812o-5p
Stem-Loop osa-MIR812o
Sequence
cguguucaacguuugacuguc
Get sequence
Deep sequencing105 reads, 2 experiments
Database links
QuickGO function

References

1