Mature sequence hsa-miR-3977

Accession numberMIMAT0019362
IDhsa-miR-3977
Stem-Loop hsa-mir-3977
Sequence
gugcuucaucguaauuaaccuua
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:20876853 "Complete characterization of the microRNAome in a patient with acute myeloid leukemia" Ramsingh G, Koboldt DC, Trissal M, Chiappinelli KB, Wylie T, Koul S, Chang LW, Nagarajan R, Fehniger TA, Goodfellow P, Magrini V, Wilson RK, Ding L, Ley TJ, Mardis ER, Link DC Blood. 116:5316-5326(2010).