Mature sequence hsa-miR-3974

Accession numberMIMAT0019359
IDhsa-miR-3974
Stem-Loop hsa-mir-3974
Sequence
aaaggucauuguaagguuaaugc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:20876853 "Complete characterization of the microRNAome in a patient with acute myeloid leukemia" Ramsingh G, Koboldt DC, Trissal M, Chiappinelli KB, Wylie T, Koul S, Chang LW, Nagarajan R, Fehniger TA, Goodfellow P, Magrini V, Wilson RK, Ding L, Ley TJ, Mardis ER, Link DC Blood. 116:5316-5326(2010).