Mature sequence mmu-miR-28c

Accession numberMIMAT0019339
IDmmu-miR-28c
Stem-Loop mmu-mir-28c
Sequence
aggagcucacagucuauuga
Get sequence
Deep sequencing180184 reads, 107 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20935160 "Next-generation sequencing identifies the natural killer cell microRNA transcriptome" Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER Genome Res. 20:1590-1604(2010).