Mature sequence oar-miR-323a-5p

Accession numberMIMAT0019259
IDoar-miR-323a-5p
Stem-Loop oar-mir-323a
Sequence
aggugguccguggcgcguucg
Get sequence
Deep sequencing30 reads, 8 experiments

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).
2
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).